#### Specific command
bash work.sh

Rscript vero_AUCG.R $input1 $input2 $output_pdf

### Supplementary Instructions
##The *fa file in the input folder come from the results of removing the hsa-Mir-21-5p sequence(TAGCTTATCAGACTGATGTTGA&TAGCTTATCAGACTGATGTTGAA&TAGCTTATCAGACTGATGTTGAG&TAGCTTATCAGACTGATGTTGAC&TAGCTTATCAGACTGATGTTGAT) from fig1/1C/*.fa and fig2/2A/*.fa
##Rscript vero_AUCG.R ./input/B2_L1_I333_miRNA.txt ./input/B3_L1_I334_miRNA.txt ./output/vero_conrol6h-miRNA.pdf
#Pay attention to the parameter setting (scale_y_continuous(limits=c(0,12))) of the bar chart, that is, the setting of the maximum value of the y-axis every time you draw a picture.
#B2 B3 Vero-Control-6h two biological duplicates
#B5 B6 Vero-Control-12h two biological duplicates
#B10 B12 Vero-Cov2-6h  two biological duplicates
#B14 B15 Vero-Cov2-12h two biological duplicates
